1% sodium azide and 0.05 mM EDTA and resuspended in the same buffer to a density of 5 × 106 cells/ml. The following anti-mouse monoclonal antibodies directed against surface antigens were used: TcR1-FITC (clone GL3) from AbD Serotec and CD19-PE-Cy5.5 (clone 6D5), CD3-APC (clone 145-2C11),

CD45-FITC (clone 30-F11), CD16/32-PE (clone 93) and CD14-FITC (clone Sa2-8) from eBioscience. Before the flow cytometry, the isolated lymphocytes were incubated with the appropriate antibodies for 30 min, washed twice in PBS and analyzed by FACSCalibur™ (BD Biosciences) equipped with a 488 nm argon-ion laser and a 633 nm diode laser. At least 105 cells were analyzed and data analyses of gated lymphocytes positive for CD45 were performed using CELLQuest™ Pro software (BD Biosciences). γδ T-lymphocytes

were identified in a single TcR-specific staining. CD19-positive B-lymphocytes and CD3-positive T-lymphocytes, and CD4 and CD8 Th- and Tc-lymphocytes, were each characterized selleck products by separate two-colour analysis. Finally, the CD14 and CD16 positive cells out of CD3 and CD19 double negative were quantified using a four-colour analysis. Real time PCR Total RNA was extracted from caecal wall samples using the RNeasy Lipid Tissue Kit (Qiagen). Resulting RNA was eluted with 50 μl RNase-free water and used immediately in reverse transcription using M-MLV reverse transcriptase (Invitrogen) and oligo-T primers. The resulting cDNA was purified by the QiaPrep PCR Purification kit (Qiagen) and used as a template for quantitative PCR. mRNA expression rates of TNFα, CP673451 solubility dmso IL-12p40, IL-18, IFNγ and iNOS were determined using the QuantiTect™ SYBR® Green RT-PCR Kit (Qiagen) with β-actin mRNA as a reference. Primers used for the RT-PCR are listed in Table 4. The threshold cycle values (Ct) of gene of interest were first Selleck OICR-9429 normalised to the Ct value of actin

reference mRNA (ΔCt) and the normalised mRNA levels were calculated as 2(-ΔCt). The normalised mRNA levels of a particular cytokine were then used for t-test comparisons between the infected and non-infected animals and are also given in figures as “”actin”" units. Table 4 List of primers used for the quantification of gene expression by real time RT PCR. primer sequence 5′-3′ length (bp) Reference TNFαFor CATCTTCTCAAAATTCGAGTGACAA 175 [34] TNFαRev TGGGAGTAGACAAGGTACAACCC     IL-12p40For GGAAGCACGGCAGCAGAATA 180 [34] IL-12p40Rev Atezolizumab AACTTGAGGGAGAAGTAGGAATGG     IL-18For CAGGCCTGACATCTTCTGCAA 105 [34] IL-18Rev TCTGACATGGCAGCCATTGT     IFNγFor AACAGCAAGGCGAAAAAGGA 92 this study IFNγRev GTGGACCACTCGGATGAGC     iNOSFor CAGCTGGGCTGTACAAACCTT 95 [34] iNOSRev CATTGGAAGTGAAGCGTTTCG     β-actinFor CTTTGCAGCTCCTTCGTTG 150 this study β-actinRev ACGATGGAGGGGAATACAGC     Statistical analysis Data were evaluated by parametric two-sample, equal variance, t-test and non-parametric Mann-Whitney test comparing the experimental groups either to the non-infected control mice or to the mice infected with the wild type S. Enteritidis.