Collecting such data and following the trend in diving fatalities in a region can be important for both tourist management and the development of specific risk control selleck kinase inhibitor strategies. Therefore, the aim of this article is to offer a retrospective analysis of fatal diving incidents in the Primorje-Gorski Kotar County (northern Croatian littoral) of Croatia

between 1980 and 2010 in order to determine the demographic characteristics of diving casualties and their secular trend with special emphasis to differences between local divers and tourists. Medico-legal aspects of death in divers were investigated through a retrospective analysis of autopsies carried out at the Department of Forensic Medicine and

Criminalistics, Rijeka University School of Medicine, Croatia between 1980 and 2010. The Department has universal coverage over the territory of two counties, the Primorje-Gorski Kotar and Lika-Senj. The Primorje-Gorski Kotar County, with a population of 300,000 people, encompasses part of the northern Croatian littoral with its islands, and is home to many interesting diving points, which makes diving accidents and fatalities more susceptible in this area. The analysis covered a period of 31 years (1980–2010) and included a total of 47 consecutive Selleck PLX3397 cases of diver deaths. The necessary pathological and biological data were retrieved from medico-legal reports and death certificates, while data regarding the circumstances and conditions which resulted in the fatal outcome were retrieved from police reports of the Ministry of Internal Affairs, Primorje-Gorski Kotar County. The variables analyzed in this study included the biological profile

of the victims (age and sex), the year and month of death, type of diving (scuba diving/ free-diving), diving Adenosine triphosphate organization (diving in a group or alone), nationality of the diver (resident or tourist), and presence of any preexisting pathological condition in the victim. The deaths were analyzed by calculating the frequency of their occurrence with regard to specific variables. While investigating temporal changes in the frequency of diving fatalities, the studied period was divided into three decades and two major periods: before and after the year 1996, that is considered to be the year that diving tourism in Croatia took off. Variations between the groups and the frequencies were analyzed with a difference test between the two proportions and a Mann–Whitney test. Results of p < 0.05 were considered statistically significant. In the period between 1980 and 2010, a total of 47 deaths in divers were registered. Most of the victims in the study were male (44/47, 93.6%). The victims fall into the young and middle-aged age group, with the majority of them between 20 and 29 years (28.3%), and 30 to 39 years (28.

Our analyses of the ΔrodZ mutant showed that the absence of RodZ leads to the reduced expression of most of the flagella genes, but not of their master regulator, which seems to suggest that RodZ does not function as a regulatory factor for this large network. It seems find more that the reduced expression could be due to stress signals from a defective cell wall. The rodZ mutant was nonmotile, but possessed flagella that were indistinguishable from those of the wild type. The expression of the motA operon required for membrane-bound components of flagellar motor and chemotactic response was most severely reduced in the mutant (Table

1). This might explain the above-mentioned phenotype of the mutant because mutations in motA and motB impaired the motility, but not the assembly Galunisertib purchase of flagellum (Blair & Berg, 1990). Cells of the rodZ mutant, however, were able to move actively in liquid medium, although the number of active cells was much less than that in the wild type. Therefore, the nonmotile phenotype might be due to both defective motor synthesis and loss of proper chemotactic function. It is also conceivable

that the weakened membrane structure and/or the altered cell shape hindered the movement of cells through soft agar, where more pressure is expected than in liquid medium. We have confirmed that rodZ and ispG comprise an operon and the absence of RodZ apparently affected the expression of ispG. Because its

overproduction is toxic to cells (GenoBase: http://ecoli.aist-nara.ac.jp/index.html), IspG might play another role in the peptidoglycan metabolism in addition to isoprene synthesis (Campos et al., 2001), although it has not yet been revealed in E. coli. In Providencia stuartii, a homologue of ispG termed aarC regulates the expression of 2′-N-acetyltransferase that contributes to the O-acetylation of peptidoglycan, and a missense mutant of aarC showed a phenotype similar to the rodZ mutant (Rather et al., 1997). O-acetylation influences the activity of lytic transglycosylases involved in the biosynthesis and turnover of peptidoglycan (reviewed Metformin supplier in Scheurwater et al., 2008). Therefore, RodZ might function in the fine-tuning of peptidoglycan biosynthesis. Plasmid pBADs-rodZΔHTH could rescue neither the sphere cell shape nor the nonmotile phenotype contrary to the recent reports by Shiomi et al. (2008) and Bendezúet al. (2009). We assume that this discrepancy is due to the amount of ΔHTH molecules expressed, because we occasionally observed elongated cells among the ΔrodZ mutant carrying plasmid prodZ-1-ΔHTH that should produce more proteins than pBADs-rodZΔHTH (Fig. 1g). The growth rate of the ΔrodZ mutant with this plasmid was also higher than that with pBADs-rodZΔHTH.

, 2009). TDP-43mutant and TDP-43SALS/FTLD are mainly present in the cytoplasm and appear to be depleted in the nucleus (Neumann et al., 2006; Winton et al., 2008; Sumi et al., 2009; Barmada et al., 2010). It therefore has been suggested that depletion of TDP-43 in the nucleus results in failure of RNA metabolism LY294002 nmr in this compartment, possibly resulting in the generation of abnormal splice variants. Alternatively, mRNA species in the cytoplasm that require the action of TDP-43 may be mistargeted or even degraded. Of interest in this regard is the finding that TDP-43 interacts with NF-L (neurofilament-light)

mRNA, which may play a pathogenic role in ALS (Strong et al., 2007; Strong, 2010). Ongoing studies aim to identify RNA abnormities in TDP-43SALS/FTLD and TDP-43mutant cells and to establish their MG-132 in vitro pathogenic role. This is obviously not easy given the large number of RNA species and the need to use unbiased approaches. In addition, it should be noted that these studies should not be limited to mRNAs, as recent studies have identified a role for microRNAs in neurodegeneration in general and in ALS in particular (Williams et al., 2009). Mislocation may also result

in pathogenicity due to a cytoplasmic gain-of-function rather than nuclear depletion (loss-of-function). There appears to be a correlation between cytoplasmic expression of TDP-43 or its C-terminal fragments and toxicity in vitro Dynein (Johnson et al., 2009; Nonaka et al., 2009; Zhang et al., 2009; Barmada et al., 2010), but it remains to be demonstrated that this

is a causal correlation. TDP-43mutant and TDP-43SALS/FTLD also appear to be abnormally processed, as C-terminal small molecular weight species, and in particular a fragment with a molecular weight of 25 kDa, are found in disease conditions (Neumann et al., 2006; Hasegawa et al., 2008). It has been suggested that caspase-3 is a TDP-43-processing enzyme (Zhang et al., 2007, 2009; Dormann et al., 2009). Expression of C-terminal fragments results in aggregate formation in vitro (Igaz et al., 2009), but the specificity of this processing and its significance for the pathogenesis remains to be shown (Dormann et al., 2009; Nishimoto et al., 2010). Of interest, the cleavage appears to be region-specific. In spinal cord, most of the TDP-43 recovered is full length (Igaz et al., 2008). TDP-43mutant and TDP-43SALS/FTLD are also hyperphosphorylated (the S409/410 sites are best characterized; Hasegawa et al., 2008; Inukai et al., 2008; Kametani et al., 2009; Neumann et al., 2009). Again, it is unclear whether these are primary or secondary modifications (Dormann et al., 2009). Overexpression of TDP-43mutant in zebrafish results in a phenotype resembling that seen with overexpression of mutant SOD1 (Lemmens et al., 2007; Kabashi et al., 2010). Knockdown of TDP-43 results in a similar motor neuron phenotype (Kabashi et al.

, 2000). This is made possible by the interaction of the Selleckchem Ku-0059436 Yersinia invasin with β1 integrins (Isberg & Leong, 1990), which are expressed on the luminal side of M cells, but not enterocytes (Clark et al., 1998). Invasion of PPs is made possible by the expression of several nonfimbrial adhesins such as invasin (Inv) and possibly Yersinia adhesin A (YadA), which can both potentially interact with β1 integrins and could mediate the adherence and invasion of M cells (Eitel & Dersch, 2002; Hudson et al., 2005). Reporter systems such as green fluorescent protein (GFP) and bacterial luciferase

(LuxAB) have been used to study Yersinia infection in mice (Kaniga et al., 1992; Oellerich et al., 2007). The drawback of the GFP reporter is that it is very stable, Venetoclax chemical structure and thus its expression responds only slowly to environmental changes. Furthermore, it can be toxic for cells when expressed at high levels (Greer & Szalay, 2002; Rang et al., 2003). LuxAB, which requires the addition of a substrate for measuring enzyme activity, has been used for monitoring yersiniae only in feces (Kaniga et al., 1992). In contrast, luxCDABE codes not only for luciferase (LuxAB) but also for the enzymes involved in substrate synthesis (LuxCDE). Enzymes encoded by the luxCDABE operon of Photorhabdus luminescens are stable at 37 °C and above (Meighen, 1993). In contrast to the fluorescence of GFP, the bioluminescence of LuxCDABE

requires metabolically active BCKDHA bacteria. Therefore, this method allows live noninvasive imaging of live bacteria. The luxCDABE reporter has been used to study infection by a wide range

of bacteria such as Listeria, Staphylococcus aureus, Salmonella, and Escherichia coli (Francis et al., 2000, 2001; Loessner et al., 2007; Foucault et al., 2010). LuxCDABE, however, has not been used to follow Yersinia infection of PPs, lymph nodes, or spleen, even though the ability of yersiniae to form abscesses in these organs predisposes yersiniosis to the study with this reporter. To follow Yersinia infection in the mouse model, we expressed luxCDABE under control of the l-arabinose-inducible PBAD promoter, which has been shown to be tightly regulated in vivo (Loessner et al., 2007). Deletion mutant WA-C(pYV∷Cm) Δinv was constructed by λ red-mediated recombination replacing the promoter and the entire coding region of inv with a spectinomycin cassette. Mutagenesis was performed as described previously (Trülzsch et al., 2004) using the forward primer: cgcatta gattaatgcatcgtgaaaaatgcagagagtctattttatgagaagtggcggttttcatgg cttg and the reverse primer: ggtcacgctaaaggtgccagtttgctggg ccgcaagattggtatttagcacattatttgccgactaccttg. The luxCDABE operon under the l-arabinose-inducible araBAD promoter (PBAD) was integrated downstream of glmS in Y. enterocolitica WA-C(pYV∷Cm)Δinv and Y. enterocolitica WA-C (pYV∷Cm) by triplate mating. Escherichia coli strain S17.1λpir harboring plasmid pHL289 (Loessner et al.

, 2000). This is made possible by the interaction of the CH5424802 solubility dmso Yersinia invasin with β1 integrins (Isberg & Leong, 1990), which are expressed on the luminal side of M cells, but not enterocytes (Clark et al., 1998). Invasion of PPs is made possible by the expression of several nonfimbrial adhesins such as invasin (Inv) and possibly Yersinia adhesin A (YadA), which can both potentially interact with β1 integrins and could mediate the adherence and invasion of M cells (Eitel & Dersch, 2002; Hudson et al., 2005). Reporter systems such as green fluorescent protein (GFP) and bacterial luciferase

(LuxAB) have been used to study Yersinia infection in mice (Kaniga et al., 1992; Oellerich et al., 2007). The drawback of the GFP reporter is that it is very stable, selleck chemicals llc and thus its expression responds only slowly to environmental changes. Furthermore, it can be toxic for cells when expressed at high levels (Greer & Szalay, 2002; Rang et al., 2003). LuxAB, which requires the addition of a substrate for measuring enzyme activity, has been used for monitoring yersiniae only in feces (Kaniga et al., 1992). In contrast, luxCDABE codes not only for luciferase (LuxAB) but also for the enzymes involved in substrate synthesis (LuxCDE). Enzymes encoded by the luxCDABE operon of Photorhabdus luminescens are stable at 37 °C and above (Meighen, 1993). In contrast to the fluorescence of GFP, the bioluminescence of LuxCDABE

requires metabolically active PLEK2 bacteria. Therefore, this method allows live noninvasive imaging of live bacteria. The luxCDABE reporter has been used to study infection by a wide range

of bacteria such as Listeria, Staphylococcus aureus, Salmonella, and Escherichia coli (Francis et al., 2000, 2001; Loessner et al., 2007; Foucault et al., 2010). LuxCDABE, however, has not been used to follow Yersinia infection of PPs, lymph nodes, or spleen, even though the ability of yersiniae to form abscesses in these organs predisposes yersiniosis to the study with this reporter. To follow Yersinia infection in the mouse model, we expressed luxCDABE under control of the l-arabinose-inducible PBAD promoter, which has been shown to be tightly regulated in vivo (Loessner et al., 2007). Deletion mutant WA-C(pYV∷Cm) Δinv was constructed by λ red-mediated recombination replacing the promoter and the entire coding region of inv with a spectinomycin cassette. Mutagenesis was performed as described previously (Trülzsch et al., 2004) using the forward primer: cgcatta gattaatgcatcgtgaaaaatgcagagagtctattttatgagaagtggcggttttcatgg cttg and the reverse primer: ggtcacgctaaaggtgccagtttgctggg ccgcaagattggtatttagcacattatttgccgactaccttg. The luxCDABE operon under the l-arabinose-inducible araBAD promoter (PBAD) was integrated downstream of glmS in Y. enterocolitica WA-C(pYV∷Cm)Δinv and Y. enterocolitica WA-C (pYV∷Cm) by triplate mating. Escherichia coli strain S17.1λpir harboring plasmid pHL289 (Loessner et al.

Decisions regarding the optimum management of early preterm ROM require the assessment of a number of factors including the exact gestation, the facilities available, maternal

viral load and the presence of other co-morbidities such as infection and pre-eclampsia. Corticosteroids to improve fetal lung maturation should be given Metformin research buy as per the Royal College of Obstetricians and Gynaecologists guidelines [272] and (if delivery is to be delayed) oral erythromycin [273]. Decisions regarding timing of delivery should be made in consultation with the full multidisciplinary team including the neonatal unit. There is no evidence that steroids for this website fetal lung maturation (with the associated 24-hour delay in induction) are of overall benefit at 34–37 weeks’ gestation in women with ruptured membranes, thus delay for the optimization of fetal lung maturity is not recommended. For this reason, and also to minimize the risk of developing chorioamnionitis, induction is recommended from 34 weeks’ gestation in women with ruptured membranes who are not in labour. If the maternal viral load is not fully suppressed, consideration should be given to the options available to optimize therapy.

An additional concern is that the early preterm infant may be unable to tolerate oral therapy and therefore loading the infant through the transplacental route with maternal therapy is recommended (See Section 5: Use of antiretroviral therapy in pregnancy). There is most experience with maternal oral nevirapine 200 mg stat > 2hours prior to delivery, PTK6 but double-dose tenofovir and standard-dose raltegravir can also be considered. 7.4.1 Intrapartum intravenous zidovudine infusion is recommended in the following circumstances: For women with a viral load of > 1000 HIV RNA copies/mL plasma who present in labour, or with ruptured membranes or who are admitted for planned CS. Grading: 1C For untreated women presenting in labour or with

ruptured membranes in whom the current viral load is not known. Grading: 1C In women on zidovudine monotherapy undergoing a PLCS intravenous zidovudine can be considered. Continued oral dosing is a reasonable alternative. Grading: 1B There are no data to support the use of intrapartum intravenous zidovudine infusion in women on cART with a viral load < 1000 HIV RNA copies/mL plasma. The use of intravenous zidovudine is suggested for women taking zidovudine monotherapy as per Recommendation 5.3.4. The use of intravenous zidovudine for women on cART with a viral load between 50 and 1000 HIV RNA copies/mL can be considered regardless of mode of delivery. However, continued oral dosing of their current regimen is a reasonable alternative.

334 (294–334) KU-60019 clinical trial mg/dL in those not on a PI (P < 0.01).

Because most participants in our study on a PI were on ATV (36/51), it stands to reason that one is a marker for the other. The strength of this study is the large number of participants, allowing for adequate power to address the study question. There are limitations, however. Because ART was not randomized in this study, unmeasured confounding or confounding by indication could be the reason for the results obtained. Cardiovascular risk may have contributed to the decision to prescribe an ATV-based regimen. If this were true, FMD may have been impaired to a greater extent in patients receiving ATV and may have masked the effect of bilirubin. However, cardiovascular risk factors were balanced between the participants, including those not Selleck BEZ235 modifiable, i.e. age, sex and race. Also, adjusting for cardiovascular risk factors did not change the results qualitatively. In addition, we were unable to control for time on ATV or prior ART exposure. As suggested above, an effect may have been seen if participants had recently been started on ATV; however, the clinical benefit of a transient effect of this intervention would be

questionable. Another limitation is the lack of adjustment for multiple statistical tests, which could have increased the likelihood of finding statistical significance from chance alone. Finally, because of the cross-sectional design, it is not possible to attribute cause to effect. Given the negative results of this study, these last two points are less important, but should be taken into account in the design of future studies. In conclusion, neither ATV use nor higher total bilirubin levels were statistically associated with better endothelial function or lower inflammation and oxidation in virologically suppressed, HIV-1-infected adults on stable ART. It is possible that the antioxidant and/or the anti-inflammatory effect of bilirubin is transient or is observed only with very high levels triclocarban of bilirubin, or that it is not sufficiently potent to overcome other causes of endothelial dysfunction in this population. The authors would like to thank the patients who participated

in this research. This work was funded by the National Institute of Health (NR012642), Bristol-Myers Squibb and the Campbell Foundation and received support from the Case Center for AIDS Research (NIH Grant Number: A136219). COH has received research grant support from Bristol-Myers Squibb. CTL has received research grant support from Bristol-Myers Squibb. TLC serves on the DSMB of Prairie Education and Research Cooperative, has received research grant support from Baxter, Inc. and is on the speaker’s bureau for Sanofi-Aventis. GAM has received research grant support and serves as a consultant for GlaxoSmithKline, Bristol-Myers Squibb, Gilead Sciences, and Tibotec and currently serves as the DMC Chair for a Pfizer-sponsored clinical trial. All other authors have no conflicts.

Efavirenz CNS toxicity during the initial phase of treatment may be related to Cmax, regardless of the sampling time. A plasma therapeutic range of 1–4 µg/mL has been established for the nonnucleoside reverse transcriptase inhibitor efavirenz [1,2], and great variation in the pharmacokinetics of the drug exists within and between patients, causing variation in drug concentrations [3–6]. Factors reported to be associated with interpatient variability in efavirenz concentration

include gender, ethnicity and genetic polymorphisms [3,4,7,8,36], while autoinduction and adherence [8,9] may contribute to both inter- and intrapatient variability. Female gender has been reported to be associated with higher efavirenz concentrations and a larger volume of distribution [3,4,7], while Black patients have

been reported to exhibit lower GDC 0199 rates of clearance of the drug and hence higher plasma concentrations [10]. A recent study comparing 24-h efavirenz pharmacokinetics between HIV-infected patients and healthy volunteers after a selleck chemical single dose showed patients with HIV/AIDS to have lower efavirenz oral bioavailability compared with healthy volunteers when genetics and gender were controlled for [11]. Certain polymorphisms of the gene encoding the major enzyme responsible for efavirenz metabolism, CYP2B6 (an enzyme belonging to the cytochrome P450 group of liver enzymes), have been found to be associated with low clearance of the drug, resulting in high plasma concentrations [3,12–14], and adverse reactions to efavirenz [15]. These polymorphisms, notably CYP2B6*6 and CYP2B6*11, are present at high frequencies Non-specific serine/threonine protein kinase in Black populations, causing slower clearance of the drug in a large proportion of individuals in these populations

[4,7]. A study conducted in the Netherlands with predominantly Caucasian participants reported 18.9% of participants with concentrations above the therapeutic range [3], while a study conducted among Zimbabweans in Africa showed that 50% of the study population exhibited efavirenz plasma concentrations above the therapeutic range [4]. Caucasians have subsequently been reported to have an average intrinsic hepatic clearance rate 28% higher than that of Africans and Hispanics [10]. In addition, other factors, including autoinduction, contribute to inter- and intraindividual variability in efavirenz pharmacokinetics. The clearance of efavirenz has been shown to increase from the baseline value as a result of autoinduction [8], although the timing and the extent to which efavirenz induces its own metabolism differ among studies. While Zhu et al. [8] observed a 2-fold increase in efavirenz clearance at steady state from baseline values, Kappelhoff et al.

The tooth was then prepared for a SSC, which was fixed with glass ionomer luting cement (Hy-Bond GI CX®, Shofu, Kyoto, Japan). One paediatric dentist performed all treatment. At the 6–11 month and 12–29 month recalls, clinical and radiographic examinations were performed by another paediatric dentist who was blinded to which treatment group the teeth had been assigned. The intra-examiner reliability was 100%

and 90% for the clinical and radiographic evaluations, respectively. The criteria used for determination GSK1120212 of clinical and radiographic success were as follows: (i) absence of a fistula, swelling of the periodontal tissue, and/or abnormal tooth mobility; (ii) absence of clinical symptoms of irreversible pulpitis such as spontaneous pain or pain persisting after removal of the stimulus; (iii) an intact lamina dura and the absence of radiolucency at the bifurcation or periapical regions or thickening of HDAC inhibitor the periodontal

space which would indicate the presence of irreversible pathology or necrosis; (iv) absence of internal or external root resorption. If canal obliteration was observed, it was not regarded as a treatment failure[22]. Partial discontinuity of the lamina dura in some areas and/or thickening of the periodontal space, which could not definitively indicate the presence of irreversible pathology or necrosis, were observed at the first recall. We classified these teeth into an ‘observe’ group for further evaluation at the next recall. All of the radiographic criteria were evaluated by periapical radiograph examination. The preoperative radiographs of a mandibular first and second primary molar treated with CH-IPT and 3Mix-MP, respectively, are seen in Fig. 1a and of a CH-IPT-treated mandibular first primary molar is shown in Fig. 2a. The presence of deep carious lesions approaching the pulp, as well as intact

lamina dura can be observed, and neither internal/external resorption nor interradicular/periapical radiolucencies can be seen. Any teeth showing both clinical and radiographic success were recorded as overall treatment success. Those that showed clinical and/or radiographic signs or symptoms of irreversible pulp pathology Phenylethanolamine N-methyltransferase or necrosis were recorded as overall failures. The Pearson chi- square and Fisher, s exact tests at the 95% confidence level were used to analyse the differences between the percent of overall success in both groups. At the 6–11 month recall (mean = 7.12 ±1.36 months), 76 of 82 mandibular primary molars were available for clinical and radiographic evaluation. Two of 41 teeth in the CH-IPT group (5%) and 4 of 41 teeth (10%) in the 3Mix-MP group dropped out. The distribution of teeth evaluated at 6–11 months by tooth type and treatment method is shown in Table 1. None of the teeth in either group showed clinical signs/symptoms of irreversible pulpitis or necrosis such as pain, fistula, or enhanced tooth mobility.

’ In terms of endocrine problems, the Atlas reported on diabetes-related amputations,

the percentage of people recorded as receiving nine key diabetes care processes, and rates of bariatic surgery.1 For amputation the results show a variation from around 1.5 per 1000 patients with type 2 diabetes undergoing lower extremity amputation in South East England and the West Midlands to 3 per 1000 patients in South West England. The percentage of patients receiving nine key care processes in diabetes varied from 2% to 70% across all primary care trusts in England. What factors may contribute to a two-fold variation in amputation and a 35-fold Ceritinib ic50 variation in process of care? Firstly, it should be asked whether the association is due to artefact or is a real association that does not appear to be explained by chance, bias or confounding. It is also crucial to consider whether

the measurement is an appropriate reflection of quality of care. Using amputations as an example (Atlas map 3) it is important to recognise that although amputations are a reasonable guide of foot care, early amputation can sometimes be a better outcome than delayed or absence of amputation2 which may even precipitate early death. Secondly, the interpretation of the data needs examining. AG-014699 molecular weight The data presented are adjusted for differences in the distribution of age and sex between different populations. However, other variables, such as deprivation, smoking status and ethnicity, which are known to be associated with risk of amputation and vary by region and could therefore confound the association, do not appear to have been considered in the comparisons of amputation rates. It may be that regions with lower amputation rates have diagnosed more patients with early onset in diabetes. In itself this is not a bad thing, but it will increase the denominator when calculating the rates of amputation. This LY294002 results in a lowering of rates

due to a statistical quirk rather than anything to do with improved foot care. It would thus be useful to know the adjusted prevalence of diagnosed diabetes in each region, or the rates of amputation per total population, as this would help in the interpretation of the data. Additionally, many patients in hospital with diabetes and co-existing conditions are not recorded as having diabetes.3 Rayman showed that only 74% of patients with diabetes undergoing amputation were recorded as having diabetes,4 and recent data from Scotland indicate that the proportion of people with diabetes who had diabetes recorded in routine hospital data varied from 34–88% between hospitals5 reflecting a large variation in a relatively small geographical area. In addition, many patients, who were diagnosed as having diabetes during the admission that led to an amputation, may not be recorded on discharge data as having diabetes.